🧬DNA Translator

About this tool

Paste a DNA or RNA sequence, written 5′ to 3′; spaces, numbers and FASTA headers are ignored. The tool shows the base count and GC content, the complement and reverse complement, the mRNA transcript, and the protein sequence in each of the three reading frames, using one-letter or three-letter amino acid codes, with the longest open reading frame highlighted. Each result has a copy button.

How DNA becomes protein

Genes are stored in DNA as sequences of four bases, A, C, G and T. DNA is double-stranded: A pairs with T and G with C, so each strand is the complement of the other, running in the opposite direction. The reverse complement is the partner strand read in its own 5′ to 3′ direction, which matters when designing primers or reading a gene on the other strand. In transcription, a cell copies the gene into messenger RNA, which uses U in place of T. In translation, ribosomes read the mRNA three bases at a time; each three-base codon specifies one of 20 amino acids according to the genetic code, with AUG (methionine) usually starting a protein and UAA, UAG or UGA stopping it. Because a sequence can be read starting at the first, second or third base, there are three possible reading frames, and the right one is normally the one with a long open reading frame from a start codon to a stop codon. ATGGCCATTGTAATGGGCCGCTGA translates to MAIVMGR followed by a stop. GC content, the share of G and C bases, affects DNA stability and is a common quality check. Honest limits: this uses the standard genetic code (mitochondria and some organisms differ), shows only the forward strand's frames, and doesn't splice out introns. The Punnett square calculator and the blood type calculator are related.

Frequently asked questions